locus

name
VrZAG79
chromosome
5
UniSTS code
502576
GenBank code
BV722842
alleleSizeMin
230
alleleSizeMax
270
order priority
950.0
pdf
not available

This is a predefined locus.

primer forward
name
VrZAG79 [F]
sequence
agattgtggaggagggaacaaaccg
annealing temperature
50.0
length in bases
25
primer reverse
name
VrZAG79 [R]
sequence
tgcccccattttcaaactcccttcc
annealing temperature
50.0
length in bases
25
related bibliography (1)
authors year title journal citation
Sefc KM, Regner F, Turetschek E, Gloessl J, Steinkellenr H 1999 Identification of microsatellite sequences in Vitis riparia and their applicability for genotyping of different Vitis species. Genome 42:367-373
updated at
2010-02-24 15:19:48.884214