locus

name
VVMD5
chromosome
16
UniSTS code
502567
GenBank code
AY124798
alleleSizeMin
215
alleleSizeMax
287
order priority
990.0
pdf
not available

This is a predefined locus.

primer forward
name
VVMD5 [F]
sequence
ctagagctacgccaatccaa
annealing temperature
56.0
length in bases
20
primer reverse
name
VVMD5 [R]
sequence
tataccaaaaatcatattcctaaa
annealing temperature
56.0
length in bases
24
related bibliography (1)
authors year title journal citation
Bowers JE, Dangl GS, Vignani R, Meredith CP 1996 Isolation and characterization of new polymorphic simple sequence repeat loci in grape (Vitis vinifera L.). Genome 39:628-633
updated at
2019-06-25 11:40:27.781