locus

name
VVMD7
chromosome
7
UniSTS code
502486
GenBank code
not available
alleleSizeMin
180
alleleSizeMax
270
order priority
980.0
pdf
not available

This is a predefined locus.

primer forward
name
VVMD7 [F]
sequence
agagttgcggagaacaggat
annealing temperature
52.0
length in bases
20
primer reverse
name
VVMD7 [R]
sequence
cgaaccttcacacgcttgat
annealing temperature
52.0
length in bases
20
related bibliography (1)
authors year title journal citation
Bowers JE, Dangl GS, Vignani R, Meredith CP 1996 Isolation and characterization of new polymorphic simple sequence repeat loci in grape (Vitis vinifera L.). Genome 39:628-633
updated at
2011-03-07 09:46:56.541237