locus

name
VVMD25
chromosome
11
UniSTS code
502515
GenBank code
not available
alleleSizeMin
229
alleleSizeMax
275
order priority
940.0
pdf
not available

This is a predefined locus.

primer forward
name
VVMD25 [F]
sequence
ttccgttaaagcaaaagaaaaagg
annealing temperature
56.0
length in bases
24
primer reverse
name
VVMD25 [R]
sequence
ttggatttgaaatttattgagggg
annealing temperature
56.0
length in bases
24
related bibliography (1)
authors year title journal citation
Bowers JE, Dangl GS, Vignani R, Meredith CP 1996 Isolation and characterization of new polymorphic simple sequence repeat loci in grape (Vitis vinifera L.). Genome 39:628-633
updated at
2011-09-04 14:32:26.192716