locus

name
VVMD27
chromosome
5
UniSTS code
502597
GenBank code
not available
alleleSizeMin
165
alleleSizeMax
218
order priority
970.0
pdf
not available

This is a predefined locus.

primer forward
name
VVMD27 [F]
sequence
gtaccagatctgaatacatccgtaagt
annealing temperature
56.0
length in bases
27
primer reverse
name
VVMD27 [R]
sequence
acgggtatagagcaaacggtgt
annealing temperature
56.0
length in bases
22
related bibliography (1)
authors year title journal citation
Bowers JE, Dangl GS, Vignani R, Meredith CP 1996 Isolation and characterization of new polymorphic simple sequence repeat loci in grape (Vitis vinifera L.). Genome 39:628-633
updated at
2019-06-25 11:41:26.363