locus

name
VVMD28
chromosome
3
UniSTS code
502465
GenBank code
not available
alleleSizeMin
210
alleleSizeMax
283
order priority
930.0
pdf
not available

This is a predefined locus.

primer forward
name
VVMD28 [F]
sequence
aacaattcaatgaaaagagagagagaga
annealing temperature
56.0
length in bases
28
primer reverse
name
VVMD28 [R]
sequence
tcatcaatttcgtatctctatttgctg
annealing temperature
56.0
length in bases
27
related bibliography (1)
authors year title journal citation
Bowers JE, Dangl GS, Vignani R, Meredith CP 1996 Isolation and characterization of new polymorphic simple sequence repeat loci in grape (Vitis vinifera L.). Genome 39:628-633
updated at
2014-06-16 14:12:40.864152