locus

name
VVMD32
chromosome
4
UniSTS code
502471
GenBank code
not available
alleleSizeMin
216
alleleSizeMax
290
order priority
920.0
pdf
not available

This is a predefined locus.

primer forward
name
VVMD32 [F]
sequence
tatgattttttaggggggtgagg
annealing temperature
56.0
length in bases
23
primer reverse
name
VVMD32 [R]
sequence
ggaaagatgggatgactcgc
annealing temperature
56.0
length in bases
20
related bibliography (1)
authors year title journal citation
Bowers JE, Dangl GS, Vignani R, Meredith CP 1996 Isolation and characterization of new polymorphic simple sequence repeat loci in grape (Vitis vinifera L.). Genome 39:628-633
updated at
2019-06-25 11:42:58.742