locus

name
B004
chromosome
18
UniSTS code
502557
GenBank code
not available
alleleSizeMin
not available
alleleSizeMax
not available
order priority
-1.0
pdf
not available
primer forward
name
B004 [F]
sequence
AGGTGGTGAGTAGCAACAAC
annealing temperature
not available
length in bases
20
primer reverse
name
B004 [R]
sequence
CCAGGCAAGGTCATTCTCAC
annealing temperature
not available
length in bases
20
updated at
2009-08-15 23:14:10.101754