locus

name
VrZAG25
chromosome
10
UniSTS code
502509
GenBank code
BV722839
alleleSizeMin
225
alleleSizeMax
255
order priority
-1.0
pdf
not available
primer forward
name
VrZAG25 [F]
sequence
ctccacttcacatcacatggcatgc
annealing temperature
50.0
length in bases
25
primer reverse
name
VrZAG25 [R]
sequence
cggccaacatttactcatctctccc
annealing temperature
50.0
length in bases
25
related bibliography (1)
authors year title journal citation
Sefc KM, Regner F, Turetschek E, Gloessl J, Steinkellenr H 1999 Identification of microsatellite sequences in Vitis riparia and their applicability for genotyping of different Vitis species. Genome 42:367-373
updated at
2009-10-19 20:26:12.616044