locus

name
VVIB01
chromosome
2
UniSTS code
not available
GenBank code
BV140685
alleleSizeMin
278
alleleSizeMax
318
order priority
0.0
pdf
not available
primer forward
name
VVIB01 [F]
sequence
TGACCCTCGACCTTAAAATCTT
annealing temperature
not available
length in bases
22
primer reverse
name
VVIB01 [R]
sequence
TGGTGAGTGCAATGATAGTAGA
annealing temperature
56.0
length in bases
22
updated at
2019-07-01 07:04:06.649