locus

name
VVIP31
chromosome
19
UniSTS code
not available
GenBank code
BV140665
alleleSizeMin
158
alleleSizeMax
210
order priority
0.0
pdf
not available
primer forward
name
VVIP31 [F]
sequence
TATCCAAGAGACAAATTCCCAC
annealing temperature
not available
length in bases
22
primer reverse
name
VVIP31 [R]
sequence
TTCTCTTGTTTCCTGCAAATGG
annealing temperature
56.0
length in bases
22
updated at
2019-07-01 07:08:23.766