locus

name
VVIQ52
chromosome
9
UniSTS code
not available
GenBank code
BV140763
alleleSizeMin
71
alleleSizeMax
89
order priority
0.0
pdf
not available
primer forward
name
VVIQ52 [F]
sequence
TAAAAGGATGGTAGATGACAGA
annealing temperature
not available
length in bases
22
primer reverse
name
VVIQ52 [R]
sequence
ACAGGAAAGTGTTCAATGGTTA
annealing temperature
56.0
length in bases
22
updated at
2019-07-01 07:11:58.554