locus

name
VVIP60
chromosome
1
UniSTS code
not available
GenBank code
BV140712
alleleSizeMin
291
alleleSizeMax
348
order priority
0.0
pdf
not available
primer forward
name
VVIP60 [F]
sequence
GGGGAATAACTAAATTGAGGAT
annealing temperature
not available
length in bases
22
primer reverse
name
VVIP60 [R]
sequence
GTATGAATGCGGATAGTTTGTG
annealing temperature
56.0
length in bases
22
updated at
2019-07-01 07:14:55.962